In this application, we used a HILICpak VN-50 2D to analyze unrefined product of synthetic 62-mer oligo-DNA. Under the set condition, oligo-DNAs eluted in the order of smaller to larger degree of polymerization. Up to about 30-mer oligo-DNAs are separated by this method.
Ion-pair reversed phase and ion exchange modes are often used to analyze oligonucleotides. However, deposition of ion-pair reagent on the column can be a problem. Meanwhile, ion exchange mode requires to use an eluent with high salt concentration, which is not ideal for MS detection.
The VN-50 2D allows a simple analytical condition, without ion-pair reagent nor highly concentrated salt, to separate and analyze oligonucleotides.
Sample : 1 µL
Synthesized oligo-DNA 62mer (crude) 2.8 mg/mL (in H2O)
CATGAGAAGTATGACAACAGCCCCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
Column : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm) Eluent : (A); 50 mM HCOONH4 aq./(B); CH3CN Linear gradient ; (B %) 60 % (0 to 10min), 60 % to 50 % (10 to 25min), 60 % (25.01 to 30min) Flow rate : 0.2 mL/min Detector : UV (260 nm) (small cell volume) Column temp. : 40 °C
Please select your location to continue:
For all other locations please click “close” and return to the homepage.
This website stores cookies on your computer. These cookies are used to collect information about how you interact with our website and allow us to remember you. We use this information in order to improve our services. If you are happy to accept these cookies please click “Accept” or simply continue to use our website. To find out more about the cookies we use, see “More Information”.