Nucleic acids are composed of pentacarbonate, phosphoric acid, and base. While pentacarbonate in RNA is ribose, in DNA, it is deoxyribose (hydroxyl group (OH) at the 2-position of ribose is replaced by hydrogen (H)). Phosphorothioated oligonucleic acids are often used in nucleic acid drugs, because they are more stable than regular oligonucleic acids.
In this application, synthetic oligo-DNA, synthetic phosphorothioated oligo-DNA, synthetic oligo-RNA, and synthetic phosphorothioated oligo-RNA were analyzed by LC/UV/MS using HILICpak VN-50 2D, a polymer-based HILIC column.
Under HILIC mode, the higher the hydrophilicity, the stronger the retention becomes. Thus, since synthetic oligo-RNA has higher hydrophilicity than synthetic oligo-DNA, its retention becomes longer (compare peaks 1 and 3). Meanwhile, in a phosphorothioated oligonucleotide’s phosphate linkage, an oxygen atom is replaced by a sulfur atom. This makes it more hydrophobic, and thus its retention becomes weaker than non-phosphorothioated types (compare peaks 1 and 2 and peaks 3 and 4).
The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.
Analysis of 2'-OMe and 2'-MOE Modified Phosphorothioated Oligo-RNA by LC/UV/MS (VN-50 2D)
Sample : 0.1 mg/mL each (in H2O), 1 μL
1. Synthesized oligo-DNA 20mer(crude),
ATACCGATTAAGCGAAGTTT
2. Synthesized phosphorothioated oligo-DNA 20mer(crude),
A*T*A*C*C*G*A*T*T*A*A*G*C*G*A*A*G*T*T*T
3. Synthesized oligo-RNA 20mer(cartridge purified),
AUACCGAUUAAGCGAAGUUU
4. Synthesized phosphorothioated oligo-RNA 20mer(cartridge purified),
A*U*A*C*C*G*A*U*U*A*A*G*C*G*A*A*G*U*U*U
* means phosphorothioated position
Column : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm) Eluent : (A)50 mM HCOONH4 aq. (pH9.8)/(B) CH3CN Linear gradient ; (B %) 64 to 56 % (0 to 10 min), 56 % (10 to 20 min), 56 to 64 % (20 to 20.01 min), 64 % (20.01 to 25 min) Flow rate : 0.3 mL/min Detector : UV (260 nm) (small cell volume), ESI-MS (SIM Negative) Column temp. : 40 °C
Please select your location to continue:
For all other locations please click “close” and return to the homepage.
This website stores cookies on your computer. These cookies are used to collect information about how you interact with our website and allow us to remember you. We use this information in order to improve our services. If you are happy to accept these cookies please click “Accept” or simply continue to use our website. To find out more about the cookies we use, see “More Information”.