• HOME
  • Product Search
  • Application Search
  • Distributors
  • Support

Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)

Print

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were 20mer synthetic oligo-DNAs: one with the target base sequence and its three analogs with 1 to 3 base alterations. By having different bases make their hydrophilicities different from each other. Four synthetic oligo-DNAs were separated by HILIC mode using this hydrophilicity differences. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.



Sample : Synthesized oligo-DNAs (crude),1 μL
1. 20mer, ATACCGATTAAGCGAAGTTT
2. 20mer, ATACCGATTAAGCGAATTTT
3. 20mer, ATACCGATTAAGCTAATTTT
4. 20mer, ATACCGATTAATCTAATTTT


Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A) 50 mM HCOONH4 aq. /(B) CH3CN
               Linear gradient;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min), 
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃

Contact us