Synthetic oligo-DNAs of 19 and 20mer were analyzed using HILICpak VN-50 1D and VN-50 2D. The VN-50 1D with an inner diameter of 1.0 mm improves the sensitivity of LC/MS by lowering the flow rate. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.
Sample: 0.4 µL
0.05 mg/mL each (in H2O/CH3CN=50/50)
- 1.Synthesized oligo-DNA 19mer(crude)
TTCTCATGGTTCTTCGGAA - 2.Synthesized oligo-DNA 20mer(crude)
CTTCTCATGGTTCTTCGGAA

- Column
- :Shodex HILICpak VN-50 1D (1.0 mm I.D. x 150 mm)
Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm) - Eluent
- :(A);50 mM HCOONH4 aq. /(B); CH3CN
Linear gradient ;
(B %) 65 to 50 % (0 to 20 min), 50 to 65 % (20 to 20.01 min), 65 % (20.01 to 25 min) - Flow rate
- :0.1 mL/min (VN-50 1D)
0.3 mL/min (VN-50 2D) - Detector
- : ESI-MS (SIM Negative)
- Column temp.
- :40 ℃
Sample Name Index
Operation Manual / Certificate of Analysis
Operation Manuals and Certificate of Analysis / Inspection Certificate for the following products can be downloaded here.
Product Name Index
Applications
- LC/UV/MS Analysis of Oligo-DNA (VN-50 2D)
- Analysis of Phosphorothioated Oligo-DNA (VN-50 2D)
- Analysis of Oligo-DNAs (VN-50 2D)
- Analysis of Various Oligonucleotides by LC/UV/MS (VN-50 2D)
- Analysis of 2'-OMe and 2'-MOE Modified Phosphorothioated Oligo-RNA by LC/UV/MS (VN-50 2D)
- Analysis of 10 - 50mer Oligo-DNAs (VN-50 2D)
- Analysis of Oligonucleotides and Their Impurities (1) Truncated Oligonucleotides (VN-50 2D)
- Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)
