Synthetic oligo-DNAs of 19 and 20mer were analyzed using HILICpak VN-50 1D and VN-50 2D. The VN-50 1D with an inner diameter of 1.0 mm improves the sensitivity of LC/MS by lowering the flow rate. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.



Sample : 0.05 mg/mL each (in H₂O/CH₃CN=50/50), 0.4 µL
1. Synthesized oligo-DNA 19mer(crude), TTCTCATGGTTCTTCGGAA
2. Synthesized oligo-DNA 20mer(crude), CTTCTCATGGTTCTTCGGAA

Column       : Shodex HILICpak VN-50 1D (1.0 mm I.D. x 150 mm)
               Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH4 aq. /(B) CH3CN
               Linear gradient ;
               (B %) 65 to 50 % (0-20 min)→50 to 65 % (20-20.01 min)→65 % (20.01-25 min)
Flow rate    : 0.1 mL/min (VN-50 1D), 0.3 mL/min (VN-50 2D)
Detector     : ESI-MS (SIM Negative)
Column temp. : 40 ℃