High Sensitive Analysis of Synthetic Oligo-DNAs by LC/MS (Comparison between VN-50 1D and VN-50 2D)

Synthetic oligo-DNAs of 19 and 20mer were analyzed using HILICpak VN-50 1D and VN-50 2D. The VN-50 1D with an inner diameter of 1.0 mm improves the sensitivity of LC/MS by lowering the flow rate. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.

Sample: 0.4 µL
0.05 mg/mL each (in H2O/CH3CN=50/50)

  1. 1.Synthesized oligo-DNA 19mer(crude)
    TTCTCATGGTTCTTCGGAA
  2. 2.Synthesized oligo-DNA 20mer(crude)
    CTTCTCATGGTTCTTCGGAA
Chromatogram of Synthesized oligo-DNA
Column
：Shodex HILICpak VN-50 1D (1.0 mm I.D. x 150 mm)
Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent
：(A);50 mM HCOONH4 aq. /(B); CH3CN
Linear gradient ;
(B %) 65 to 50 % (0 to 20 min), 50 to 65 % (20 to 20.01 min), 65 % (20.01 to 25 min)
Flow rate
：0.1 mL/min (VN-50 1D)
0.3 mL/min (VN-50 2D)
Detector
： ESI-MS (SIM Negative)
Column temp.
：40 ℃

Sample Name Index

Operation Manual / Certificate of Analysis

Operation Manuals and Certificate of Analysis / Inspection Certificate for the following products can be downloaded here.

Product Name Index

Applications