Synthetic oligo-DNAs of 10, 20, 30, 40, and 50mer were analyzed using HILICpak VN-50 2D. Under the given condition, the oligo-DNAs eluted in an order of shorter to longer-chains. Optimization of the gradient condition improved the separations of longer chain oligo-DNAs. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.
Sample : 0.02 mg/mL each (in H2O), 1 μL
1. Synthesized oligo-DNA 10mer(crude),
TTCTTCGGAA
2. Synthesized oligo-DNA 20mer(crude),
CTTCTCATGGTTCTTCGGAA
3. Synthesized oligo-DNA 30mer(crude),
TGTTGTCATACTTCTCATGGTTCTTCGGAA
4. Synthesized oligo-DNA 40mer(crude),
CCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
5. Synthesized oligo-DNA 50mer(crude),
GACAACAGCCCCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
Column : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm) Eluent : (A)50 mM HCOONH4 aq. (pH9.8)/(B) CH3CN Linear gradient ; (a) 60 % B (0 min) to 50 % B (10 to 20 min) to 60 % B (20.01 to 25 min) (b) 65 % B (0 min) to 45 % B (10 to 20 min) to 65 % B (20.01 to 25 min) Flow rate : 0.2 mL/min Detector : UV (260 nm) (small cell volume) Column temp. : 40 °C
Sample Name Index
Operation Manual / Certificate of Analysis
Operation Manuals and Certificate of Analysis / Inspection Certificate for the following products can be downloaded here.
Product Name Index
Applications
- High Sensitive Analysis of Synthetic Oligo-DNAs by LC/MS (Comparison between VN-50 1D and VN-50 2D)
- LC/UV/MS Analysis of Oligo-DNA (VN-50 2D)
- Analysis of Phosphorothioated Oligo-DNA (VN-50 2D)
- Analysis of Oligo-DNAs (VN-50 2D)
- Analysis of Various Oligonucleotides by LC/UV/MS (VN-50 2D)
- Analysis of 2'-OMe and 2'-MOE Modified Phosphorothioated Oligo-RNA by LC/UV/MS (VN-50 2D)
- Analysis of Oligonucleotides and Their Impurities (1) Truncated Oligonucleotides (VN-50 2D)
- Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)